A novel glucocorticoid receptor binding element within the murine c-myc promoter

Tianlin Ma, John A. Copland, Allan R. Brasier, E. Aubrey Thompson

Research output: Contribution to journalArticle

8 Citations (Scopus)


In the course of analyzing the murine c-myc promoter response to glucocorticoid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocorticoids activate c-myc/reporter constructs that contain this element. Deletion of these sequences from the c-myc promoter increases basal activity of the promoter and blocks glucocorticoid induction. Insertion of this element into SV40/reporters inhibits basal reporter gene activity in the absence of glucocorticoids. Glucocorticoids stimulate activity of reporters that contain this element. Recombinant glucocorticoid receptor binds to this element in vitro. An unidentified cellular repressor also binds to this element. The activated glucocorticoid receptor displaces this protein(s). We conclude that the glucocorticoid receptor binds to the c-myc promoter in competition with this protein, which is a repressor of transcription. To our knowledge, no glucocorticoid response element with such properties has ever been reported.

Original languageEnglish (US)
Pages (from-to)1377-1386
Number of pages10
JournalMolecular Endocrinology
Issue number9
StatePublished - 2000


Glucocorticoid Receptors
Response Elements
Sequence Deletion
Reporter Genes

ASJC Scopus subject areas

  • Molecular Biology
  • Endocrinology, Diabetes and Metabolism

Cite this

Ma, T., Copland, J. A., Brasier, A. R., & Thompson, E. A. (2000). A novel glucocorticoid receptor binding element within the murine c-myc promoter. Molecular Endocrinology, 14(9), 1377-1386.

A novel glucocorticoid receptor binding element within the murine c-myc promoter. / Ma, Tianlin; Copland, John A.; Brasier, Allan R.; Thompson, E. Aubrey.

In: Molecular Endocrinology, Vol. 14, No. 9, 2000, p. 1377-1386.

Research output: Contribution to journalArticle

Ma, T, Copland, JA, Brasier, AR & Thompson, EA 2000, 'A novel glucocorticoid receptor binding element within the murine c-myc promoter', Molecular Endocrinology, vol. 14, no. 9, pp. 1377-1386.
Ma, Tianlin ; Copland, John A. ; Brasier, Allan R. ; Thompson, E. Aubrey. / A novel glucocorticoid receptor binding element within the murine c-myc promoter. In: Molecular Endocrinology. 2000 ; Vol. 14, No. 9. pp. 1377-1386.
title = "A novel glucocorticoid receptor binding element within the murine c-myc promoter",
abstract = "In the course of analyzing the murine c-myc promoter response to glucocorticoid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocorticoids activate c-myc/reporter constructs that contain this element. Deletion of these sequences from the c-myc promoter increases basal activity of the promoter and blocks glucocorticoid induction. Insertion of this element into SV40/reporters inhibits basal reporter gene activity in the absence of glucocorticoids. Glucocorticoids stimulate activity of reporters that contain this element. Recombinant glucocorticoid receptor binds to this element in vitro. An unidentified cellular repressor also binds to this element. The activated glucocorticoid receptor displaces this protein(s). We conclude that the glucocorticoid receptor binds to the c-myc promoter in competition with this protein, which is a repressor of transcription. To our knowledge, no glucocorticoid response element with such properties has ever been reported.",
author = "Tianlin Ma and Copland, {John A.} and Brasier, {Allan R.} and Thompson, {E. Aubrey}",
year = "2000",
language = "English (US)",
volume = "14",
pages = "1377--1386",
journal = "Molecular Endocrinology",
issn = "0888-8809",
publisher = "The Endocrine Society",
number = "9",



T1 - A novel glucocorticoid receptor binding element within the murine c-myc promoter

AU - Ma, Tianlin

AU - Copland, John A.

AU - Brasier, Allan R.

AU - Thompson, E. Aubrey

PY - 2000

Y1 - 2000

N2 - In the course of analyzing the murine c-myc promoter response to glucocorticoid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocorticoids activate c-myc/reporter constructs that contain this element. Deletion of these sequences from the c-myc promoter increases basal activity of the promoter and blocks glucocorticoid induction. Insertion of this element into SV40/reporters inhibits basal reporter gene activity in the absence of glucocorticoids. Glucocorticoids stimulate activity of reporters that contain this element. Recombinant glucocorticoid receptor binds to this element in vitro. An unidentified cellular repressor also binds to this element. The activated glucocorticoid receptor displaces this protein(s). We conclude that the glucocorticoid receptor binds to the c-myc promoter in competition with this protein, which is a repressor of transcription. To our knowledge, no glucocorticoid response element with such properties has ever been reported.

AB - In the course of analyzing the murine c-myc promoter response to glucocorticoid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocorticoids activate c-myc/reporter constructs that contain this element. Deletion of these sequences from the c-myc promoter increases basal activity of the promoter and blocks glucocorticoid induction. Insertion of this element into SV40/reporters inhibits basal reporter gene activity in the absence of glucocorticoids. Glucocorticoids stimulate activity of reporters that contain this element. Recombinant glucocorticoid receptor binds to this element in vitro. An unidentified cellular repressor also binds to this element. The activated glucocorticoid receptor displaces this protein(s). We conclude that the glucocorticoid receptor binds to the c-myc promoter in competition with this protein, which is a repressor of transcription. To our knowledge, no glucocorticoid response element with such properties has ever been reported.

UR - http://www.scopus.com/inward/record.url?scp=0033761696&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=0033761696&partnerID=8YFLogxK

M3 - Article

VL - 14

SP - 1377

EP - 1386

JO - Molecular Endocrinology

JF - Molecular Endocrinology

SN - 0888-8809

IS - 9

ER -