Skip to main navigation Skip to search Skip to main content

A novel glucocorticoid receptor binding element within the murine c-myc promoter

  • Tianlin Ma
  • , John A. Copland
  • , Allan R. Brasier
  • , E. Aubrey Thompson

Research output: Contribution to journalArticlepeer-review

Abstract

In the course of analyzing the murine c-myc promoter response to glucocorticoid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocorticoids activate c-myc/reporter constructs that contain this element. Deletion of these sequences from the c-myc promoter increases basal activity of the promoter and blocks glucocorticoid induction. Insertion of this element into SV40/reporters inhibits basal reporter gene activity in the absence of glucocorticoids. Glucocorticoids stimulate activity of reporters that contain this element. Recombinant glucocorticoid receptor binds to this element in vitro. An unidentified cellular repressor also binds to this element. The activated glucocorticoid receptor displaces this protein(s). We conclude that the glucocorticoid receptor binds to the c-myc promoter in competition with this protein, which is a repressor of transcription. To our knowledge, no glucocorticoid response element with such properties has ever been reported.

Original languageEnglish (US)
Pages (from-to)1377-1386
Number of pages10
JournalMolecular Endocrinology
Volume14
Issue number9
DOIs
StatePublished - 2000
Externally publishedYes

ASJC Scopus subject areas

  • Molecular Biology
  • Endocrinology

Fingerprint

Dive into the research topics of 'A novel glucocorticoid receptor binding element within the murine c-myc promoter'. Together they form a unique fingerprint.

Cite this