@article{44d5e1a3ed39463e98afee316e4025f6,
title = "Expression and purification of biologically active domain I of the human polymeric immunoglobulin receptor",
abstract = "Previous studies using proteolytic fragments and synthetic peptides have indicated that domain I of human polymeric immunoglobulin receptor (PlgR) is necessary for ligand binding. The expression in E. coli, and subsequent IgM-affinity purification of domain I of human PlgR is described. The recombinant domain I protein (rDI) was similar in structure to native SC domain I in that it bound specifically to MAb 6G11, an antibody which recognizes a critical portion of the PIg binding site in domain I. The biological activity of rDI was indicated by high affinity binding to PIgA (Kd = 1.6 × 10-7 M) and IgM (Kd = 5.1 × 10-7 M). Domain I of human SC is therefore sufficient for binding to PIg.",
author = "Bakos, \{Mary Ann\} and Widen, \{Steven G.\} and Goldblum, \{Randall M.\}",
note = "Funding Information: MATERIALS AND METHODS Cloning of human PlgR domain I DNA. A Agtl 1 clone containing an insert encoding the complete human PlgR sequence was isolated from an HT29 cell cDNA library generously provided by Drs. Keith Mostov and Neil Simister (P. H. Fritz and R. M. Goldblum, unpublished data). The PlgR clone was identified by hybridization with a synthetic nucleotide corresponding to the inverse complement of nucleotides 61-90 of the partial PlgR DNA sequence published by Krajci et a/. (1989). The nucleotide sequence of our PlgR clone was essentially identical to the sequence published by Piskurich et a/. (1993). The Agtl 1 PlgR clone was used as a template to generate DNA encoding domain I of human SC via the polymerase chain reaction. Synthetic nucleotide primers designed to flank the 5{\textquoteright} and 3{\textquoteright} ends of domain I were produced by Bio-Synthesis Inc. (Lewisville, TX), The 5{\textquoteright} primer (5{\textquoteright} GATATACATATGAAGAGTCCCATATT 3{\textquoteright}) contained sequence corresponding to the Nde I restriction site of the pRSET-B plasmid (InVitrogen Inc, San Diego, CA) as well as the first 14 nucleotides of SC DNA sequence. The 3{\textquoteright} primer (5{\textquoteright} GTCAGCCTGGAGGTCTAGCTCGAGATC 3{\textquoteright}) contained sequence information for the inverse complement of SC codons 105-109, a termination codon and an Xho I restriction endonuclease cleavage site. The amplified DNA was digested with Nde I and Xho I restriction endonucleases and ligated into similarly digested pRSET-B plasmid DNA. The recombinant plasmid DNA was transformed into competent DH5u f. co/i (Gibco BRL, Gaithersburg, MD) according to the manufacturers instructions. Transformants were screened for the {\textquoteleft}This work was supported by the National Institute of Allergy and Infectious Diseases (Al21 412). Child Health and Human Development (P30 HD27841l and John Scaly Memorial Endowment for Biomedical Research to R.M.G.",
year = "1994",
month = feb,
doi = "10.1016/0161-5890(94)90088-4",
language = "English (US)",
volume = "31",
pages = "165--168",
journal = "Molecular Immunology",
issn = "0161-5890",
publisher = "Elsevier Limited",
number = "2",
}