Skip to main navigation Skip to search Skip to main content

Finding of novel telomeric repeats and their distribution in the human genome

  • Sathyalakshmi Alaguponniah
  • , Deepa Velayudhan Krishna
  • , Sayan Paul
  • , Johnson Retnaraj Samuel Selvan Christyraj
  • , Krishnan Nallaperumal
  • , Sudhakar Sivasubramaniam

Research output: Contribution to journalArticlepeer-review

Abstract

Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats “CACAGA” and “TCTCTGCGCCTGCGCCGGCGCGGCGCGCC” and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.

Original languageEnglish (US)
Pages (from-to)3565-3570
Number of pages6
JournalGenomics
Volume112
Issue number5
DOIs
StatePublished - Sep 2020
Externally publishedYes

Keywords

  • Aging
  • Loop
  • Novel repeats
  • Telomere

ASJC Scopus subject areas

  • Genetics

Fingerprint

Dive into the research topics of 'Finding of novel telomeric repeats and their distribution in the human genome'. Together they form a unique fingerprint.

Cite this